DNA Sample

AACAACGAAGTTGATGCTACGCAAACGCAACAAGAATTAACTTTTGCAGGCATGAATGCTGGTGATGTGTTTGGGGCAGTGATCGACCGGACATTAGGACCTATGTCTTAGCACGGCATAGTCTGATAGTCTTGTCCAAAAGCATTGCTCCGAGCGGATCAAATGTATAATAGACCATGTCTCCCGAATTCTTCGGCGCCGCCACGCCGACTTGACCACATGTTTCCATGCCTTCCCGGTGTGGGTTTTATTGGGCTTGGCTTCGAGAGATCAGTGCGCAGATAGCCCATTGTGTCGCCACCCCTATAGAAAAAAGCGTGCGAAATGGATTCAATTCGTTTAATAAGCGCTAATAAGGTGGGAGGTGTCCTACTACTGTGTGGTGGAACTTTCTCTGTTTCGAGCAAAGTGCCACTTCAAATTCGAAAATTCCTTGTTTCGCTAGATCCTCCGAGAAGAAGACTTCGTACATGTTATGCAGGCAGTCTGCTACCTCGCAGGACCAACTTTACCCCACGTTAGTCTGGCAGAGTCTTGCGCAGGCATCCGAAGTTTGCGACAAATCTGTACAATGGTGTAAAAGTTCCCTCGACGTTGGGGTTTGCCGTAGTATCTGTCTGGGGAAGTGACCTAACGCTCCGCGCGCTCGTACCGCCAAAACCTGCCAGACTGGCTCTTGCGGGTCTACTAGCCCTGGTATAACTCCAAAGGGCACGACTTGCATTTGCGGATGGGATGATAGCCTGTTTTGCATCTGTCCCCAATGAGAACATGGGACCAATCCGGACCCGTTGTGATCATGAGCGACACCACTCTCGATTGGGACCAAGATACGCTGTTAAACTCACTCATTGCATGATACGCGAGCTCCTGCACGAGGCGCCAGCTCCGCGCGACCGAGTTAATGGAAACTCGTATTCCCGTGCAAGGAACACCTTTTTACGCTGCTCGAGCTCGTCACCAGCCTCATAATCGACAGACAAACTCTTGTATATCCGGGCGGAAACCCTCGTCGCATATCAACATGCCATTGCTGGATTTACTCAAGTACCACGAAAGGACCGTACCCAAACCTGCTACAGGATACAATGAATGTTTAAAACCGATTAAAAGGACGCCGATGCGCAGACGACTCTACTACTATGAAAGGTGCCTAGAGTCATGACGAGCATAAGGAGTGAGCGTAGGAACCAAAACGATTAGTAAGCTCTTTACGCTACTCTAGTATCCTACCTGGCTCGGACTGAACACCGACATCTAGGAAAAGGCCTATTCGCCGTGAAAACAAGTACGCCGCTAGATGTGAGACATTATTCATCGTCTCGATTTTGTGATAACAGCTCGGCTGAACTCAAACTTAGCAAGTCGACACCGTTTGGTGTTATTAATTCCCCGTATCAAGCCACCTTTGGGCGCCGGACTCGATCAGTATCCACGCAGAGAGAGACAGCCCGACGCCAACTCGAGCCGTGCTACCAGCGTGTCGATACAAGTGCTAGCTCTAATCCATGGGAGTTGTTATTGGCTGGCTCGGCGCGTCCCATGGGCACAAATTTCGCTAAAGGCCTTACAGCTATCCTTCATATGCCTACTAACCCCACGATTTTGCACACCTGAGTGCATCATGGATGGCTCAGCGTCATTCTCGCAAGATTCTGTTCCCTATTTAGGCGGATCCCGGCAGCATAGGTTACGAAGTAAGCGAGCCTTTCATACTTCCGCCGGTGGCGGCATTACCCCAAGATGGTGTAAACGGCAAGGGAGGTGTATAATTCTCTGTGGTTACCCGGTAATTGTCGTCGAACCTTACGGAGCATTCCCAGCACATGGGTAGAGTTCTCTGCCTCCGGGTGACGCCCATATTGTCGTGCAGTCTTGACATCGTGCCTGCGGACCATTTCATTAATTGTAGGCAGTCTGAAAGAGTACGTGTGGTGCGAAGGTATCTAAGAAGTAAGCCCAAATGTCTCGTTAGTTTTATCATTTAAGCCTCCTATGGGTAGGAAGAACATGATCATCGATCCAAGAGAGCAATACCACGAAACTGC

Advertisements